EY755968

Overview
NameEY755968
Unique NameEY755968
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length703
Alignments
Feature NameTypeLocationAnalysis
EY755968_ssr530 microsatellite EY755968_ssr530:530..541.
Csv1_Contig1915 contig Csv1_Contig1915:229..908. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-A12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755968 ID=EY755968|Name=EY755968|organism=Citrus sinensis|type=EST|length=703bp
TTCCGTCGACCCACGCGTCCGAGCTTGAATTACAGCCAGTAAGAGTTGTG
CACGGAGGGCAAAAAAAAAAAAAAGCATGGGGAAATAATAATCGCTGATG
GGATTGAGAGGTGGNTGTCTTAGCAGCGATCATAGTTATGGATGATACTC
GTTCTTCTCCGCGAATCAANTCTTGTGCTGCAGGCAACATTACTAATTTC
CATATTGATCCTGATGTGTTGTTCTTTCATGATGATCCAGAATTGGAATT
GGCTGCTGCTCCGACTTCTAATAAAGCATTGGATCCCAGTCAAGCATTCG
GTTGCGGAAGACCCGGAAGCATTCGCTCTTGTCCCCCTCATCCCAATGCC
CCCAAAAAGCCCGATCATTGCGCACCTCCCCCCGGCAGCACGTATGCCCC
AGCCAAACGAGATTGCTAGCTAGTTTATGATACATCTTTAATCTGCAATC
TTCATCTTTATCCTCAACTATGCCATGATGTGGGTTTATTCTGCATATGC
ATGTTGTATTTAATTTATATAAGTAGCTATAATTAATTAATAATCTCTCT
TTCCCATCCCTTCTTAATTCTATCTGTCTATATATTATTAATAATTAAGC
CTTAAGCTTGTACTGCTGCATCCATGCATAATTGCATATGCATTAATAAA
TAAATTAATTGAAACTTGTAAAAAAANAANNANNAAAAAANAAAAAAAAA
AAA
back to top