EY755906

Overview
NameEY755906
Unique NameEY755906
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length275
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3555 contig Csv1_Contig3555:550..825. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-001-C06-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755906 ID=EY755906|Name=EY755906|organism=Citrus sinensis|type=EST|length=275bp
TTTCAACGACCCACGCGTCCGCTAATTTCTGACTCTTAATTGAGATAAGT
CTCTCATAATTATTCTCTTTAAGTGTATGGCAGTGTTGTTATTAATTATT
CTTCTTTATTTTAATTGTATTGGAGCTGTCTTAAGTGTCGTGGTGATACA
TTTATTAATAGTTTTTATGTTTTGAATTTGTATGCGGTACGATCAAGCAT
TAATGGTTGATCGGATTGTTAATGAATAATTGATTGATATTTGTAATCAA
AAAAAAAAAAAAAAAAAAAAAAAAA
back to top