EY755901

Overview
NameEY755901
Unique NameEY755901
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length920
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-001-B12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755901 ID=EY755901|Name=EY755901|organism=Citrus sinensis|type=EST|length=920bp
CATCAGCCGCACGCGTCCGAAAAAAAANGTGGCTAAAAAAGAGAAAAAAA
AAAAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAAAATTTTTACCCAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGGGTTTT
GGGGGTTCTAAGTTTTATGTTATGGGTGGTTGTGGGAGTTTTTATTTTTT
TTTTTAAGGGGGCCTGTAAATTAATTTAGTGGTGCGGGTTTTTTAAAACG
TTGTTGTTTGGGAAATCTTTTGGGTTTACCCATTTTTTTTTCTTTGTAGC
ATTTTCTTTTTTTTGTTTTTTGGTTTTTTAGGAAAAAGGCCCGCTTTGTT
CGCCTTTTCCTATTTTTGGGGAGCTTGATTGTTAATTGGGACCCCCCTTG
TTGGGGGGATTAAATCGGGGGGTGTGTGGGGTTTTTCCCCTGTGTGTTTG
TTACTTTTGCCTGCGCTTTAGGGCCGGTTTCTTTGGTTTTTTTCCTTTTT
TTTTTCCCCGCTTTTGTGGGTTTTCTCCTGTGGTTTTTAAATCGGGGGTT
TTTTTTGGGGTTCGGTTTTGGGGTTTTCGGGTACTTCGATTTTTAAAATT
TGTTTTGGGTTTGGGGGTTCTGTATTGGGGTTCCTCTTTTTTTTAGGGGT
TTTCCCTTTTTACTTGGGATTCCCTGTTTTTTTTTTGGGACTTTTGTTCT
ATGTGGAAAATTCTTTTTTTTTCTGCGGTGTTGGTTTTTGATTGTTAGGG
GTTGGGCGATTTTGGCGTTTTGGGCAAATATTGGTGTGGTTTAAAAATAT
TTAAGGCTATTTTTGAAATATTTTGTTCTTTATTTTTGGTGGCTTCTTGT
GGGATTTTGTTGCGCACCCTTTTTTTGTTTTTTTTGTATCTTTCATTTGT
TTTTTAGTGGAATATTTTGT
back to top