EY755707

Overview
NameEY755707
Unique NameEY755707
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length868
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2250 contig Csv1_Contig2250:29..897. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-031-F06-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755707 ID=EY755707|Name=EY755707|organism=Citrus sinensis|type=EST|length=868bp
TCCAATCAAACGCCAACTCGATCTCTGGAGCTTGGAGTGGGTGTGGGTGG
ATATTGGCGCTTCATTCCATGGCCGTCGTTACAAATTTCATTTTAAAACT
CCCTTTGTCTCTCTCAGCAAACCCTAAATTTACTCCTCTACGTTCCCCTC
ATTCTCTTTTTTCACCGCCTATTTTCGCCAAACCTCAGTCTTTAACAAAA
CCGAAAACTAGCAGAACCCAGTTATTGATAACAAAGGCCACAGCTGCCCC
AGGAACAAAGAATGCTCCAAGGGATGAAAGAGTAAAGAAAGTCCACAGTA
TTGAAGAATTCGACGAAGCCCTAAGATTGGCGAAAAACAAACTCGTTGTG
GTTGAATTTGCTGCTAGCCGCAGTCTCGACAGCAGCAAAATCTACCCTTT
TATGGTTGACCTGAGCAGGCAATGCAACGACGTCGAATTCATTCTTGTGA
TGGGCGATGAGTCTGAAAAAACAAAAGAGCTCTGCGAAAGAGAGAAGATA
AAAAAGGTTCCCCACTTCAGCTTTTACAAAAGCATGGAGAAAATTCATGA
AGAAGAAGGAATAGGCCCCGATCAGCTCATGGGGGATGTGTTATATTACG
GTGACAGTCATTCTGCTGTGGTGCAGCTTCACTCCAAAGAGGATGTTGAG
AAGCTGATTGATGATCATAAGGTTGATCANAAACTGATTGTTCTTGATGT
GGGGGTGAAGCATTGTGGGCCCTGCGTGAAAGTGTATCCCACGGTGATTA
AACTGTCTANGCANATGGCCTGTAACGGTGGTCTTCCCGAGAATGACCGT
GATGANAACGACAGCTGCATGCAGTTTTTGAGGGAATGAACGTTGTTGAA
GTGCCAACATTTTGTTAT
back to top