EY755703

Overview
NameEY755703
Unique NameEY755703
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length522
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-031-F02-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755703 ID=EY755703|Name=EY755703|organism=Citrus sinensis|type=EST|length=522bp
AGTAGATGATGATGAAACTAACACAAAGAGGAAGGACGAGAAGAGAGAAG
AGGAGGAAGAGGGATGAGTCCTCAGATGAAGAGGATGAACTTCAACGCCG
TAGGAGGAACATTAGGAACGATAACAAGAGGAGGAGAAGTCATACACATG
CAAATGATTCTGATTCTGGTACATCCGACGATTCTGGTGGAAGGTATGAC
CGCTAGAGCCAAAGGTCTGTGACACCATCTGATTCTGATGCAAGTGGTTC
AGATGATTCACGATTTGGAAGGGGTGTAAAGAGGTCTAACTTGAATAGCC
AGTATCGCCGCCTCAGATATTATGAATAAAGACTTCCTAGGAAGTTAATA
TTTGCTGGTTTTGCCAGGATGACAAAATATGGGTGTGACGGTCCGCTATG
GAACTTCTGCGGGTTGGAACCTATCATGGTGGCATACCACGACAACAGTT
TATTGTAATCTGTCTGAACGCTCTGAATTAAACCTCATTTTTTTCCTCGT
CGTAGATGAAAAAAAACACATA
back to top