EY755695

Overview
NameEY755695
Unique NameEY755695
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length298
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6306 contig Csv1_Contig6306:1181..1478. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-031-E05-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755695 ID=EY755695|Name=EY755695|organism=Citrus sinensis|type=EST|length=298bp
TGAATCTTCCAACTCGACTAGCTAATAACTGTCATTTGTCATCCTTATTA
GTAGTTCCTCGCAATATACAGTGTCTATTCTGTACACTTAATTATCAGAT
TTTTAAGCTGAAAAACCTTGTGGTATTGTACAACAATAGAAGGTCCCCTA
TACAATCTTCTACTGTGAAGATTTATCTAGGCATTCCCTTATTTGGAACA
GTGTCATTGGTGTGTTGATTATTGGTCTTCAAATTTTCAGCTTATTAATT
TAAAGATTTTCTTCCTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top