EY755484

Overview
NameEY755484
Unique NameEY755484
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length916
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10932 contig Csv1_Contig10932:271..1186. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G12-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755484 ID=EY755484|Name=EY755484|organism=Citrus sinensis|type=EST|length=916bp
GGTTATTTTAGGGAATAGTGTAGTCACTGTTGCAGCCCTTGAACCTGTAA
GCAAATCACAGTGACGTGGTTTGCCACTGGGGTCGATGTAATGTGCTTTC
TGATCTTCGTTGTGTACTATTATGAATATTAAGGCTGTTAGTGTGCAATG
GGAGATGTTTCATGCTGTGGTACTGGTACCTGAGAAAATTATGCCATTTT
CTTTGTAATGCTTATTCTAAGGGAGCTCGTTTTGAACAGGTAATTAGAAT
TAATCATTGAATGACCAACGGAATGAATCAGCAAAGATTTAACACTTCGC
TTCCCACAAAAAAATTATTAATTAAAGAACTTTCTTAGAAATTAATATTT
AATTGGTTTAATCTATATGTTAAATATTTGTATGTGTATGTTGTGTATTT
TATCTTTTTCTTTTAATTTACTTTTTTATGAGGGGGGGCCCCTTATATAA
ATACACTGTATTTTTCCCTGTGCGCTTCCAAATCATATTTCTTCTTTTCC
TTCCCCTTAGGATAAATAAAATGGCTGTGTGTCTCAAATTTTTTACGATG
AAAAACCCTGGGGTTCCCCATTTTAAATCCCTTTTATAAATATCCCTTTT
CTCCACCGGGTATATTAGCCAAAAATCTCCCACCCTTTTCTTTTTCTAAA
ATTGGCCCCACCTCAATGGGAAGAGGCGGACCCCCTTTTCGGTCTCTTTT
ACACGCCGGTGTTTGGTTGGTCTCCCTCACCTTGCCCTTCATTTTCCCTC
CCCCCTTTGCCCCCCATCCTTCTCTCCCCCCCTTCTCTCACACCTGTGTT
GGGTTTTTTCCTTTCTTCTTAAATGGGGTTCTCTTTGAGGTGCATTAATA
GTTTTTTTGCCCCTTCCCCCAATATTCTTCTTGTGTTGCCCTCCNCTATG
GCCCACTCAATTTATT
back to top