EY755480

Overview
NameEY755480
Unique NameEY755480
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length860
Alignments
Feature NameTypeLocationAnalysis
EY755480_ssr479 microsatellite EY755480_ssr479:479..490.
EY755480_ssr374 microsatellite EY755480_ssr374:374..388.
EY755480_ssr735 microsatellite EY755480_ssr735:735..746.
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G08-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755480 ID=EY755480|Name=EY755480|organism=Citrus sinensis|type=EST|length=860bp
ATCATAAATTTCAATTAGCTTGAGCAACAACAATGGCTTTATCCAAGACT
TTCCTCCTTCTTGGCCTTGCATTGGCTCTTGTTCTTCTCATTTCCTCTGA
GGTCTCATCAGCTCGCGAGCTTGCTGAAGCAACCCACACCCAGAGTGCGG
AGGACAGGACAAGATTGGACGAAACCAAGTACGAAACTGATCATTATTGG
TACGGACACGGATATGGCCATGGACATAAATATGGTCATGGCAAGGGATA
CGGACACGGTGGATATGGACATTACGGCAAGCCTGGCCATGGAGGTCACC
CCGGACACGGTGCTGATGGAGTTGAAACCGAAGATGGAGGGAACTAAATA
AACCCTTGCTAACCTAGCTAAGCCTTCTTCTTCTTCTTCCTTGTTGGCTA
AGCTAGGTCTTTTATGAATGTGTTGCTTGCTGAAATAAATAACTAAGCTT
TAGTTTATGAATGTTTTCTTGTCAGCAAGTGTGTGTGTGTAAGGCTCGAT
ATTGAGATGTGGCCATGAATGTTCTTTTATAAGGCACCATGGTTACGTTG
ATATTGATCGGGTAATTTGTACTACTATAAAATATATAAGTGTTTTAAAA
AAAAAAAAGAAAGGCGGCCCGCCCTTCNNNTNNTNNNNNTTNNNNTNNNT
CCNNNNTNNCCNCTTNTNNCCCTTNNNTTTTCTNCNCCCCCTTNNCCCTT
CCCTCCCCCTTTTCTTCCTTNTTTNCTCCCTNAATCCCTCCCTCCCTTCC
CCCCTCTCTAAAAACAAAAAAATGCTATTCTCCCCACTCTTTACTTTTAT
CATTNTTCTTCCCNCTTATCTATTCTTNCTTCCCTCTTATTACTACTTTC
CCCCTTCGGT
back to top