EY755476

Overview
NameEY755476
Unique NameEY755476
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length895
Alignments
Feature NameTypeLocationAnalysis
EY755476_ssr557 microsatellite EY755476_ssr557:557..568.
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G03-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755476 ID=EY755476|Name=EY755476|organism=Citrus sinensis|type=EST|length=895bp
TTACCCCTTCGACCCACGCGTCCGGCCTAGCTGGTGGNTTNGCGGGTCCT
AAAAATCATTTCGTTCTTGTCGCCCCCCCTTTCGCTTCTTTTGATCGTTT
CAGGCTCGAAATGTGAAACTTGCCGTTAAATTATTGGCTCTTTGGCGGCC
TATGGTCCTCGAGCTTGCAGTTTTTTTTCTTGTTTTTGGCCCCCTTTTGC
CGTTTTTGGGCTGCTCCCAAGTGTCATGTAAGGTGTTTTTTGGCAATCTG
TGATGGACTTTGAGGTTGTCCATTGTAGTGCTGTTTGTAGCCTTTGTCTC
TAACGACTTGTGTCTGTTATTGTTCTCAGGATGGCGTCCGGGGGAGATTT
GGGTTTCCAATTGTCTGATCGCGGCGCGGAGTTAAGCTTTATTTCCCGTA
CTTTTTTCCTCTGTTACGTGTTTTTTTGGGGCTTGGTCTGGTTGTCCTGC
CTTTTTGACCGGGCTCTGTTGTGCGGCCCTCTCTTTGTCCGCTTGTGGTG
TGTGGGGTGGGGATTTCATCTTAATCTCTTCTCTTGCCCTTGGTTTTTTT
TTGTGACCTCCTCCTCCTTTAATGCCTGCCCTCTCCTTCACGTGGNTCCT
TGTTTTTCTGGGCCTGTCTTGGCTCGTTTGATGGTCTGACTTTTTGGGAT
TGCCTCCCCGTTGTCCTGGTATTAGTGTTTTGTCTCTTGTGTGTTCTCTG
TGCTCTCTCGCCCCCCCTTTTTACTGTTTCCCCTTTTTTGTCTTCTGTCT
TCGCCCCCCCTTTCCGTTTCTCACTCCTCTTCCTCTTCGCCTTTTCTCTT
CTTGTGGTGTCTTCACCCTTGGNTAGGCTCCCCTCTCCTGTTTTTCTCCC
CTCCCTTCGTTCCCTATTTCTTTCATAAAAAACACACCCTATCCC
back to top