EY755475

Overview
NameEY755475
Unique NameEY755475
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length822
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G02-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755475 ID=EY755475|Name=EY755475|organism=Citrus sinensis|type=EST|length=822bp
ATCAATCTTAATTGAATCGCAGGCCATAATTACAATTTCTATCTAATTGA
TCCCGATTTCACTTCTTTTGATCGATTCTGGCTTGAAATGTGAAAATTGC
CGTGAAATTATCGGCCTTTGGCGGTTAATGGTCCTCGAGCTTGAAATTTT
TTTTCAGATAAATCGGTCCACTTTTGTCGTTTTTGAGCTGATTCGAAGTG
TAATTTAAGGTTTTTTTGAAGAAACGGTGATGGACTTTGAGGTTCTCTAC
AGTAGTGTTCCCTGCAGCCCGTGTATCGAATGAAATTAATCAGTTAATTA
GTTGAAGATTTGATTTGAAAGATATATGGATTACTATCTCTCTCATCCCA
TTGGTCATTTAATCTTAATTTCCAATATATTATATCACCATTTATTTTTT
TTTTCTCTTTCATCTATTCTCATCTCTCCTATTCCCTTATCCTCTGCTTT
TTGTTGTGCATATTTTTCGCTTCTCCTCCTTCTATTTTCAGATGAACTAA
AGTTCCGCCCTTGCGTCATCCATATATCGCACTTATTTATTCTCCATTCA
TCTCCTTCAGCCTCCCCCCAACCCCATTCCCGTCTTATATCTACGACCAA
CTCCCTCAAGAGTATCGCATCTTTCTTCTCTATATCTTCGCTATCTATTA
TCACATTTAACTCTTTTACTTCGCGATGTTTCGTCTACCATAAATCATCC
TTCTCTCATATACTAATACAAGGGCTCGTCTGGCATTTGTTTCGCCCCTT
ATCCTCCCTGTGTGTTTTTGTGTTGTTCTTTTCGTTAGTGGGCCTCTTGC
CTTTTGTTCCTGTTTTACGTTC
back to top