EY755473

Overview
NameEY755473
Unique NameEY755473
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length523
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13769 contig Csv1_Contig13769:786..1308. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-F12-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755473 ID=EY755473|Name=EY755473|organism=Citrus sinensis|type=EST|length=523bp
AGGAGATGATGATGAAAATAAGACAAAGAGGAAGAGGAGAAGAGAGAAGA
GGAGGAAGAGGGATGAGTCCTCAGATGAAGAGGATGAACGTCAACACCGT
AGGAGGAAGAGTAGGAAGGAGAAGAAGAGGAGGAGAAGTCATAGACATGC
AAATGATTCTGATTCTGGTACATCCGATGATTCTGGTGGAAGGTATGAGC
GCAAGAGCCGAAGGTCTGTGACACCATCTGATTCTGATGCAAGTGGTTCG
GATGATTCACGAGTTGGAAGGGGTGTAAAGAGGTCTAACAAGAAGAGCCA
GAATCGCCACCGCAGAGATTGTGAATAAAGACTTCCTAGGAAGTTAATAT
TTGTTGGTTTTGCCAGGATGAGAAAATATGGATGTGACGGTCGGTAATGT
AACTTCTCCGTGATGGAACCTATCATGGAGGCAAACCACGACAACAGTTT
ATTGTAATCTGTCTGAACGCTTTGAATTAAAAGTCATTTTTTTCCTCGTA
GTAGGATGAAAAAAAAAAAAAAA
back to top