EY728718

Overview
NameEY728718
Unique NameEY728718
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length160
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-F08-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728718 ID=EY728718|Name=EY728718|organism=Citrus sinensis|type=EST|length=160bp
CACGCGTCCGGTTTTAAACCCACATTTGTCGATATGATTTTCACAGCAGG
ACATCTATTTATGATCATTCATTCGAGATTCACGTACGCAATGTGCAGGT
GATTATGCTTGTGAATTAAATTTTATTCAGTCAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
back to top