EY728709

Overview
NameEY728709
Unique NameEY728709
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length459
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11602 contig Csv1_Contig11602:70..528. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-E11-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728709 ID=EY728709|Name=EY728709|organism=Citrus sinensis|type=EST|length=459bp
ACAGCGACCAGGCGTCGTTCGATATCGCCCACTCGGTGCAACGCGTGGCC
CGTGCCCGTGGCGTGTCCAACGCGCAGATCGCCCAGGCGTGGGTAGCCAA
CCACCCGGGTGTGGACGTGATGCTGGTGGGCGCCGACACCACCGCGCAAT
TTGATAGCGCGCTTGCAGCCCTCGACACCCAATTGGATGCCGAAGAACTG
CACGAGCTGGAACGCAACTACACGCCGTGCGATGTGATCAACGACTACAC
CGCCGGCAAACGCATCCTGCGCAGCGCCCGTCCGGGCCTGGACCGCTTTA
ACCTGATAGAGGCCGTGGCATGAACCCGCTGATTCGCACAGGCAATTTCA
TCGATGGCCAATGGTCCACCGGTGGGCCGGTTTACCCGGTGCTCAACCCG
GCCAATGGCGCGCAAATCGCCGAGGTGCAACGCGCCGGAGCCGAGGAAAC
CAACCTGGC
back to top