EY728706

Overview
NameEY728706
Unique NameEY728706
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length874
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-E06-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728706 ID=EY728706|Name=EY728706|organism=Citrus sinensis|type=EST|length=874bp
CCACGCGTCCGAGCAGATGGCAGAATCTTTGAAAGAGGAAGGCCCTTTGG
TTCTCAGAGACCTTAGTGAGTGTGATCTTCTTGACCTTGTGGATTTGATG
ATATTGGAGAAGAAATGGGTAGAAGAATACCCATCTGAAAAGTCACCTTT
CAAACTTTCTGGTCTGGTTAGAAAGAAATCTTCTTTAGATCATTCTCTTG
CTGCAAATGGGTTGAGATCAATCTTTTTGAATACACCTTCAAAATCTGAC
CAGCCGAAAGTGCAAAAGCATGACGAAGAGAAACAGAGTTGGAAGATTTC
ACATGCTGGAGTTCCTGCATCTGCCATCAATAAGAATCCTAAGGACAGAT
CTAGAAATGACATATTAGCCGACTGCCAAAAGCTTGTTGATGAGATATTG
AAGGAGTACCCAGAAGGATATAATATGAGAGGCTTCAGACAACTTTTCAT
TGAGAGGTATGGCTACCATCTGGATATACAAAAACTTGGTTACCAAAAGT
TGCGGACCCTGTTGCAGATAATGCCTGNGGTGACGATTGAGTCCAGGTAT
ATGCTTCCTTCCAACAAGGTGATGTGTAGCTCTGGCCTGGAAACTTCAGA
TCCTGGCTTTGAAGAAGTTGATGCTCATCATCCATTATCTAACTCAGATA
GGGAGCTATTAGAAACGTCAAAAAAGAGTGATGATTCTGACTCTCAATGG
GAGGAGCTGGGGCCTGGTTCTAACTTGAGCTTTGACAGAAAGGCAGTGCA
ATCGGGGCTGAAGGGAGAGCCANTGAAAAAAACGAAACGGAACTTATCCG
AATATGAACCTTCGTCTCTGATGATGAATTTCAAATTCTGGGAGGAAGCC
CTCACTGCACACAACAAAAGGGCA
back to top