EY728695

Overview
NameEY728695
Unique NameEY728695
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length877
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11770 contig Csv1_Contig11770:1..878. BLAST: Citrus Unigene V1 Contigs to SwissProt
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-D01-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728695 ID=EY728695|Name=EY728695|organism=Citrus sinensis|type=EST|length=877bp
AACGGACCGGCCGCCCTGGCGCTGTTGCAGAGTGAATCCTTCGATGCGGT
GCTGCTGGATGTGCCGGAGGGCGGGTTCTCGCTGTGTTGCCAGATCCGTG
CATTGCCTGGCTGTGGCGAGCTGCCGGTGATCGCCTTGAGCACTTCATTG
CAAGCTCCGGAACGTGAGGGCTGTCATGGTGTGGGTGTCACTGATCGAGT
GGCCAAGCCAGTACGCTTCGAGGCCTTGCAGCTAGTATTGCAACTGCGGT
TGTTGCATATGGTCGAAGGTGAAAGCGCCGCCACTTAAGCGCTTATGCCA
CTTTTTTAACCCGGTTGACGGTGCTTAACTGAAATTCAGGCCTCAATGAA
CGTGGCCTTTTTTCAGGAGGCCCGTCATGAACCTGCACCAGTTCGCCGAA
ACCCACGACGTCACCAACCAGCCACCGTCCCTGGACGGCACCAACCTGTA
CCGTATCGATCTCCCCCTGCAAGAATGGTCCCGGCGCTTTGGGGCCGGCT
GGGCCGANCAGCGTATCGATACCTACGGTGCCTTGGCAGGCGGGCCGCTG
ATGGANGGCGGTTTCCTGGTCCACCANAACAAGCCGGTGTTCAGCAGTCA
TGACCGTTTTGGTCATCGTATCGACTTGGTTGAATTTCATCCGGCCTACC
ACGAACTGATGCGCACCGCGTCGAGCATGGTCTGCCGTCGTTGCGGTGGC
CCCACCACAATTCGGCGCCCATGTGGCCCGGGCGGTCATGACTTTACTGC
ACAGCCAGGCCGAAGCCGGCACGGCTGCCCGCTGACCATGACTTCGCCTG
CGTCCNGCCCTGCGCTGCAGCCGGACCTGCTGAAACTGGTTGCCGAAATC
TTCTCGACGAATAATACCACGCGACAT
back to top