EY728618

Overview
NameEY728618
Unique NameEY728618
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length815
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-006-C10-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728618 ID=EY728618|Name=EY728618|organism=Citrus sinensis|type=EST|length=815bp
CACGCGTCCGCGGACGCGTGGGCAGAGTACCTGTTTTGGCTGATATGTCG
AATTCCTAGAAATTCATTCCATCGGTTTCCATTGGTTTTAGCACAAACAG
AAACAGAGAGCCCTGGGAAAAAGTTTACTTTTGGTCGTATTATGCCCTTG
TTTCTTCATTCATCCTGGGAAAAAGTTTTACTTTTCCAAGCTGCTTTGTA
GCCAAATTTTGATGCCATCGATGCATGATTGTCATTTAGATTTTCCAAAT
AATTGTCATTTAGGTTGGGGAAAGTTATTGTCTTAATTAAATTACAGGTG
ATAAGATGCTGCTTCAATTTTGCAAGCATCTTGTACTGCGAAGATTCTGC
CCACATGAGATGCTGTGATTCTTGACGTCAGGATAACACAGGTTAAGGAT
ACTAAGCCGCTTATTATGGCAAATGTCAGAATGAAGATTGTTCACCACAC
CTGGTATGCATGATGGCCAGGAAGATTAATTGTTCACAAGCCAATTTTAT
CAGTGTTATATTTTTTGCCTCCTTTCGAGGGACATTCATCATCAATTTGA
GTAGAGAATCTTTGAAGAGAATTTTGTTGTGAGAGTTTCACAGTAGTGAA
TTCTGGGAGCTCGAACTCACTTAAGTGAGATATTANGGAGTATTGGGGAT
TTGGGTTNATGAGTATCATTATCCTTCCAGTATGTGCAAGCTCTCACTTG
TTAGAGTGTGATCTTCAACGGGTTGAGAAAGTCCTTGGAGTAAAGTTTCC
CCACCAAGCAGTGGCTGCGAAGAGGCCTATACTTTTGAAAAATTCAGTTC
CNGATTTCCTAGACG
back to top