EY728238

Overview
NameEY728238
Unique NameEY728238
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length161
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11370 contig Csv1_Contig11370:43..203. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-001-C05-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728238 ID=EY728238|Name=EY728238|organism=Citrus sinensis|type=EST|length=161bp
TTCAGCGGTCCATAACTGTTCGGTCAGGCGGATGTCCAGGGTGATGCTTT
CGTTGAGGCTGCGTTGCAGCAGCTCACCCATCGAACTTACCAATTGATTG
ATCTGTACCGGTTTTGAATCCAGCGACTGGCGACGGGAAAACGCCAGCAA
GCGGTGGGTCA
back to top