EY728237

Overview
NameEY728237
Unique NameEY728237
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length314
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-001-C04-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728237 ID=EY728237|Name=EY728237|organism=Citrus sinensis|type=EST|length=314bp
AGCATGACTTCGGCGACCTGTTGCTGGAAAACGGCTTCGCCGATCCGGTC
ATGGACCAGGAGATTCTGACGCTGACCTACCGCACCCCGGAAAAGCTGCT
GCAGGACGTGCGCGCCCTGGGCGGCAACCCCGCCGCCGGCCGCCGCGGCG
GCCTGGTCGGGCGCGACTGGCGGGCGCGCCTGTGCGCCGCGCTGGAGGCC
CAGCGCCGCCCGGACGGCGTCATCGCCCTGAGCATCGAAGTAGCCTACGG
CCACGCCTGGCGCGCCGCCACCCACCGCGGCACCGCCGGCGAGACCCGGC
TGTCGGTCAGCGCC
back to top