FK826739

Overview
NameFK826739
Unique NameFK826739
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length285
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:250..533. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionclone553 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 533, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826739 ID=FK826739|Name=FK826739|organism=Citrus sinensis|type=EST|length=285bp
ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAGACAAATAGTTTTTTTT
ATTGATACTACAATTTAAACGACCTCACAGCGCTGCTTTATTGTGGGGCA
TGTTCACGTCTCGTAATCTTCATTAACAGTTACAAGGGTTGCACTTGCAG
TTTGGTCCACACTTGCAGCCGCCCTCGGCTCCGAATCCCATCTCGGACCC
CTCAGAGTGCATCTTGACAGGAGCAACACCGAGGACGAGGGTCTCGGTGG
CGACGGTGGTGCTCTCAAAGGATCTCAAGTCAGGG
back to top