FK826738

Overview
NameFK826738
Unique NameFK826738
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length387
Alignments
Feature NameTypeLocationAnalysis
FK826738_ssr261 microsatellite FK826738_ssr261:261..272.
Properties
Property NameValue
Genbank descriptionclone543 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 543, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826738 ID=FK826738|Name=FK826738|organism=Citrus sinensis|type=EST|length=387bp
ACTTAGTTTTTTTGGGGAAACATTAGATACTAATTATTGTAGGTTTGTGG
TCTGAACAGTAGCTAAAACCTTAACCATAGTTTGAGGTTTCTTTTCTGGA
GCCATTCATGGTAATTTCAGGCAGAGATTGTGCATCATGTGCAGGATGTC
CGTGTCTCTTCAATAGAAAGCTTTCAAGTTTGCAGTCTTACAATGTAATG
ATTTGGTAAAGCATTACAATTTGTACATGTGCTGTCATCTTTTGCACTCC
TATATTTTCCTTAATTAATTAATGGAAAAACTTGAGGTTCTCACTACTCT
AACATTTGCTCAGAAGCATGTTGATATTGCAATATCCAGGTGATATGTAA
TTTTCACCTTATTTTTTTATTTCAGCATTTTTCTGGG
back to top