FK826731

Overview
NameFK826731
Unique NameFK826731
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length259
Properties
Property NameValue
Genbank descriptionclone514 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 514, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826731 ID=FK826731|Name=FK826731|organism=Citrus sinensis|type=EST|length=259bp
ACTTCACAAAGTCACTTTATGTTCAATGTTGTGGCTTTTATAGAAGGCAT
TCTTACAAAATGTTTAAGCCATGACATACCCATTAGCAAATCAAGCAAAT
GTTAGGTCCCTGTTAACCTAAGCAGAATGAGGCGCCAAATGAGTAATGGG
CAACCATTTCAAAAGTAACTTAAAATTCAAATAATATGAAAGAATAAGGA
GAAAACACAAGGAAAAATTTATAATGCTTAAAGTGATCAAAATGAATACC
TAGTTCTTG
back to top