FK826726

Overview
NameFK826726
Unique NameFK826726
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length126
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7579 contig Csv1_Contig7579:254..379. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone501 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 501, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826726 ID=FK826726|Name=FK826726|organism=Citrus sinensis|type=EST|length=126bp
ACTCAATTTCAGAGATCTCAAGTTCACGCTAGGTTATAATATGGATTTTG
AAATTTTCTTCTTTTGATTCGTTCCGCCTACCTCACTTGAATAAGATGTA
TACAATATATGATGTAAATGTGGATG
back to top