FK826696

Overview
NameFK826696
Unique NameFK826696
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length339
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5275 contig Csv1_Contig5275:241..579. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone359 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 359, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826696 ID=FK826696|Name=FK826696|organism=Citrus sinensis|type=EST|length=339bp
ACTGCACACAGTGATGGAGATTTTGATTCTCCAACTGTTTCAACCGCCCA
CACAAGTGGAGCTGCTGGGGTCACACACCTTGGTGTTGTAGGAAGAGGTG
TCAAGCGTGTATCAATGAGCACAGGATCAGCAGAATCAAGGCCATCGAAG
AAATCCACATCAGACCCTTCATCTGACAAAGGGGATGGGAGTGTCTGTTG
ATGTGTCTGGGTCTTTTAAAGCTTACCATTTGAATGATGTGAATGTGGGT
GGTTGATTTCCTTCCTCACCGGACTTTAGGTTTATTTTGCCAGGCTTGTT
TTAAAGATAGGTTTCCTCTGTGGCTTTAGTGAATTGGAG
back to top