FK826695

Overview
NameFK826695
Unique NameFK826695
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length104
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6214 contig Csv1_Contig6214:1188..1291. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone354 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 354, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826695 ID=FK826695|Name=FK826695|organism=Citrus sinensis|type=EST|length=104bp
ACCCTACAGCCTTAAATTTCACATGCCTGGGAACTCGTTAGAGCCAACTG
GAACCCGTGCTCCAGCCACTCGAAATCTCTATTACTCATTCGATATGGGG
GTGG
back to top