FK826693

Overview
NameFK826693
Unique NameFK826693
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length110
Properties
Property NameValue
Genbank descriptionclone349 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 349, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826693 ID=FK826693|Name=FK826693|organism=Citrus sinensis|type=EST|length=110bp
ACCCAAAATTTTAGATACAGCTCACGTAATATTTCATTAATTCTTTTAAC
TTTTCAATCAATCCTTCCATGTCATGTAAACTGCTTACTCAATTCGTACA
AAGATCTTTG
back to top