FK826689

Overview
NameFK826689
Unique NameFK826689
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length113
Properties
Property NameValue
Genbank descriptionclone328 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 328, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826689 ID=FK826689|Name=FK826689|organism=Citrus sinensis|type=EST|length=113bp
ACGCTACTGCTGGCTCTTCCGTTTGCATTATTGGCACGGCTGTGGGAGTT
ACGATAGCTACTGTGGGTGTTGCTACTCATGCGATTTTTGCCATCTTTGC
TGGTCCATTATGT
back to top