FK826686

Overview
NameFK826686
Unique NameFK826686
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length467
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig92 contig Csv1_Contig92:425..891. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone286 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 286, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826686 ID=FK826686|Name=FK826686|organism=Citrus sinensis|type=EST|length=467bp
ACTCTAAGAGAAGAAAGCCCAAGCATGAGTCCGAGTATGAGTCCTAGTAT
GTCGCCCTTTAACAATGCTGGAATGAAACGCGCCTAGACCGGAAGATAAC
ATGTTATACATATCAATGATGAAATGGACCATCGATGAACCACTGGATCA
CTGCAGCTGATGGATTGCTGTCCTGACAATCTTCATTGGTTTTGTTCTTC
AGAACCTTGGGGAGGGACTTGATTCGAGAACAGTTGGTCGAAATCCTGAG
TTAGTTTTGCGCTCAACTGTTGGCATCTCAGACGGGTATCTGCTTCCCAT
GTTTGTGTTCTATATAGCTAACATGTTTGTCAGCAATCATGATTCTTTGG
TGTATTATTCCTCTTGAGTATCGAATTTGTTACTTAATGGATTAAAAGAA
ACTCATTCCCTAATTAATTTTTATTTGCTATTCCAGCCTGCAGCTGAAGT
GATATGACCTTTGAATG
back to top