FK826681

Overview
NameFK826681
Unique NameFK826681
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length172
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4509 contig Csv1_Contig4509:852..1023. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone276 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 276, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826681 ID=FK826681|Name=FK826681|organism=Citrus sinensis|type=EST|length=172bp
ACTTGTGTCATGACGAAAGATGTTGTGTGCTTATTACTGTAGTAATTTTA
TGGGTGATCAACCCTTCTCTTTCGTTTTATTTTTCCTATTAGAATCTCAA
GAGAACTTTAGTATCATACACGCTACGGAGCATTTGTTGTTTCCTACGAT
TCAATGGCGTCAGTCGAACATG
back to top