FK826679

Overview
NameFK826679
Unique NameFK826679
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13055 contig Csv1_Contig13055:43..372. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone274 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 274, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826679 ID=FK826679|Name=FK826679|organism=Citrus sinensis|type=EST|length=330bp
ACATTGTTCACCTTGGTCTTCCTACACTTGGTGTCACTACAGAACCTGAG
TTAAACACTGTTGGGCAGGCTTCTGATGATCTAGAGCAAATTGCAAACCC
TGTTGCATTGGCACCATCACAATCCCGTAGATATGATAATCGGCCTGAGG
TCCGAAGACAGTCCTACATCGAAATGCAGATCTTCAGAAATAGGTGGAAA
CATGCGGTAGAGGACGACAAATGTTGGGTCGATCCATATGGACAATCAAC
AAACCAAACCAGTCATTAATTCTATAAACATATTATAGGGCATTCTTGGA
AGCATCAAACAAGATTTTGCTTCAAACATG
back to top