FK826675

Overview
NameFK826675
Unique NameFK826675
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length151
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionclone263 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 263, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826675 ID=FK826675|Name=FK826675|organism=Citrus sinensis|type=EST|length=151bp
ACACCCATTTATAAGTGCATCAAATCCAACAAAATCATCAATGGTAATAC
TCCATGGCTCCATATAACAAACCCAGATGGAAAACACCTCAGATGCATTC
TTGATCGAAGTCCCCACCGGACAAAACAAGAATGTCCTCAAAATAAACCT
G
back to top