FK826645

Overview
NameFK826645
Unique NameFK826645
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length180
Properties
Property NameValue
Genbank descriptionclone053 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 053, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826645 ID=FK826645|Name=FK826645|organism=Citrus sinensis|type=EST|length=180bp
ACATTGCCACACATATTACTCGAATGAAGCATAAAGGATCTAAGAGGTTT
CCTTGCATGAAAGTTTATTATGCCCTATACCCTTGCACTTGGTGCAAGTA
ACTGTTCTATGCTCTATGCCCAGAATTTTCCGTCTTCTCTTCTGATGGGT
TGTTGGTGTTCGGGTGGAGGATGGAGGAAG
back to top