FK826643

Overview
NameFK826643
Unique NameFK826643
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length206
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FK826643_ssr97 microsatellite FK826643_ssr97:97..108. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5460 contig Csv1_Contig5460:570..775. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone431 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 431, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826643 ID=FK826643|Name=FK826643|organism=Citrus sinensis|type=EST|length=206bp
ACGTATACATAGGAAAGTATGGGTAGTTCATCAACCTATGAATGACTGTA
GATATTATTTCTTTCTGTTTAACCAAGATCTGGGACAGTGAAATGCTCAT
CATCATCATCTGGGATCTCAATCCTTGGCTTCTTGTATGGCATATTGAAT
TTTGTGGGCCTGTATGATGATATTAAGTTGTTGGACTGGGACACCGGGAG
TTGAGG
back to top