FK826642

Overview
NameFK826642
Unique NameFK826642
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length101
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13683 contig Csv1_Contig13683:1..101. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone422 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 422, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826642 ID=FK826642|Name=FK826642|organism=Citrus sinensis|type=EST|length=101bp
ACGCGGGGGAAGAACGAAAGAAAGATGTCTCACTTCGGGAGGTCAGGACC
TCCAGATATCACCGACACTTACTCTCTTCTCGTCCTCAACATAACCTTCC
G
back to top