FK826641

Overview
NameFK826641
Unique NameFK826641
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length131
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8575 contig Csv1_Contig8575:625..755. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone420 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 420, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826641 ID=FK826641|Name=FK826641|organism=Citrus sinensis|type=EST|length=131bp
ACTTCAGAATCCAGAAGAGAAGAAACAGCTGAATTCCGATCAGATACAGG
ATGAACCTGCACAAGACGGACTTCAATTGCGGGTCTATTTCTCGGATCAT
GAGCCAAATGTAGTAATCTCTTGTGCATAAG
back to top