FK826640

Overview
NameFK826640
Unique NameFK826640
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length228
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12920 contig Csv1_Contig12920:50..277. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone419 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 419, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826640 ID=FK826640|Name=FK826640|organism=Citrus sinensis|type=EST|length=228bp
ACAGCATAATCTACTCGGAATGTGACCTCCTTTCCTATGCAGAGCTTCCT
CAGAAATTCTCTGCTGTCCCATGCAAATGGCTCATCTAAACCACCTCTGC
GGGCCAGCCGAGGTGTAATAATAGATGATAAAGTGAGAGTTTTTTCCCGT
GGAGGTCCAGGATTCGGGTTGGACAAGGCTGTTATCACCAAGCTGTCACC
AGATGGAACAGCTTTCACTCTTGCTCTG
back to top