FK826639

Overview
NameFK826639
Unique NameFK826639
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length101
Alignments
Feature NameTypeLocationAnalysis
FK826639_ssr19 microsatellite FK826639_ssr19:19..36.
Properties
Property NameValue
Genbank descriptionclone418 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 418, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826639 ID=FK826639|Name=FK826639|organism=Citrus sinensis|type=EST|length=101bp
ACTACTGATGTTCACCATCAGCAGCAGCAGCAGCAGTATCACGGCGGCGA
ACACAAGGAGGGCTTGGTGGACAAGATCAAGCAGCAGATCCCCGGCGTCG
G
back to top