FK826632

Overview
NameFK826632
Unique NameFK826632
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length140
Properties
Property NameValue
Genbank descriptionclone397 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 397, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826632 ID=FK826632|Name=FK826632|organism=Citrus sinensis|type=EST|length=140bp
ACCAAAAATGCAGAAGAACAAACAGTTCAATGACTGATTTTTTTTATGTA
TGGTTTGATTTTGTGGGGTAGATTTAAAAGACTTCAAAGTATGCGATTTG
TATATAAATATCACATATATTATACAATTTGTGTGATTTG
back to top