FK826630

Overview
NameFK826630
Unique NameFK826630
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length138
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11084 contig Csv1_Contig11084:583..720. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone388 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 388, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826630 ID=FK826630|Name=FK826630|organism=Citrus sinensis|type=EST|length=138bp
ACTGTCGAGTGGTCGAGGAGGTGAATCCAATCGCTGGTGATCTGATGAAA
CCTTGTGTGGCCTGGGCTGCGCTCTTGTCCCTCGTTAATCTGAAGCTCGT
CTTTAGCTGAATTTTGGCGGTCAATGAATGTTGTTATG
back to top