FK826627

Overview
NameFK826627
Unique NameFK826627
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length173
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7862 contig Csv1_Contig7862:948..1120. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone378 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 378, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826627 ID=FK826627|Name=FK826627|organism=Citrus sinensis|type=EST|length=173bp
ACAGCACGCGGCATGTGATGATGTTAATATGTTTTAATTTTTCTTTTTTT
TTAGGAAGTTATTAAATGTAGTGTTCCAAAAATGTTATATCAAATCAGTA
GTGTGTCTTATTTGTTTTATCAAGTTAAAAAAAAAAAAAAAAAAAGAAAA
AAAAAAAAAAAAAAAAAAAAAAG
back to top