FK826626

Overview
NameFK826626
Unique NameFK826626
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length102
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2663 contig Csv1_Contig2663:470..571. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone376 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 376, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826626 ID=FK826626|Name=FK826626|organism=Citrus sinensis|type=EST|length=102bp
ACTTCTTGCAATCCTGTTACTGGGATCAATCTTCAGAACAGTCCTCAGGT
CCTCAGCTCCAAGTTTATACTTTTCCATGCTTTCATACAGGAGTGCACGC
TG
back to top