FK826625

Overview
NameFK826625
Unique NameFK826625
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length172
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9015 contig Csv1_Contig9015:1143..1314. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone375 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 375, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826625 ID=FK826625|Name=FK826625|organism=Citrus sinensis|type=EST|length=172bp
ACGCCGAAGGAGGCGTTCAGCATCCTCCTCAGCTTCCATCTGCTCCTTGA
GGTAGAGCAAATCATCACTGTCCAAAGCTCCACGGCCATGAAGATGACCG
CCACGTTCACCAGCAACTTCTTGCATCTTGGCAACCATGCGCTGAAAAGT
GATGTCTTCATCGTCTCCCGCG
back to top