FK826623

Overview
NameFK826623
Unique NameFK826623
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length116
Alignments
Feature NameTypeLocationAnalysis
FK826623_ssr82 microsatellite FK826623_ssr82:82..99.
Csv1_Contig13688 contig Csv1_Contig13688:285..400. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionclone367 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 367, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826623 ID=FK826623|Name=FK826623|organism=Citrus sinensis|type=EST|length=116bp
ACCGACACCGGGGATCTTCTGCTTGATCTTGTCCACCAAGCCCTCCTTGT
GTTCGCCCTCCCTGTGTTCCCCGCCGTGATACTGCTGCTGCTGCTGCTGA
TGGTGAACATCAGTAG
back to top