FK826622

Overview
NameFK826622
Unique NameFK826622
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length230
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13682 contig Csv1_Contig13682:1..229. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone366 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 366, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826622 ID=FK826622|Name=FK826622|organism=Citrus sinensis|type=EST|length=230bp
ACGCGGGGGGGCCCAAAAAACAAAAAAGTATAAAAGATTACAGGGAAAGT
CGATTTAGGGTAGGCGCGGCGGTGCTCACAATGAAGACCATTACCATTGA
TCTGCGAGTGCTATTTTGTGTACTCAACAAGGTCATCGTTACTTCTTGCT
TAATAGAACCGCGGCAAAAAAAAATTTGTTGAAGGAAAAGTTCGGATGTT
CAATAACAGCAAGCGTCCCAATTCGGTTCG
back to top