FK826621

Overview
NameFK826621
Unique NameFK826621
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length103
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2551 contig Csv1_Contig2551:534..636. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone364 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 364, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826621 ID=FK826621|Name=FK826621|organism=Citrus sinensis|type=EST|length=103bp
ACGCCAAAAGTCGAACAAGAGGGTCACTTGCCGGCCCCAGTAGAAGGTCA
TGTGCATCATCTTCGCAGCTCGGTTTTGGATTTCCGGAAAAAAAAAAAAA
TTG
back to top