FK826620

Overview
NameFK826620
Unique NameFK826620
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length212
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2248 contig Csv1_Contig2248:58..269. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone362 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 362, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826620 ID=FK826620|Name=FK826620|organism=Citrus sinensis|type=EST|length=212bp
ACGCGGGAGAAAAGAAAAAAAGAGGAATAAAAAAAATTCAAAGATCTGCA
TCTGCTGAAAGAATTGCATTAGATCGTTCGGGAAAGGAAATGGAAGGACT
GAACAACTCGTATGGAACATCATGGGCAGATCAATGGGACGATGGGCCGG
ACCCAATATCGGTGGTGCCTCAGAAAAAGAGGAGCAATAATAATGGAACA
GGAGCAGCAAAG
back to top