FK826619

Overview
NameFK826619
Unique NameFK826619
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length195
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9309 contig Csv1_Contig9309:1453..1644. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone361 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 361, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826619 ID=FK826619|Name=FK826619|organism=Citrus sinensis|type=EST|length=195bp
ACCGACGTGATGTCCCCGATTATTGTGATGGTTATTATGATTGCTGTTGT
GATGACTGTTGTTATGGTGGCTGTTGTTGTGGTATTGACCACGATCATTC
CGGCCACGTCCTTTTCCACGACCCTTGTTACGCCCTTTTCTCTGTCCACC
CTCTTTCTCATTATTGTGCTCCTCTCCTGTATGGTCATGTGACTG
back to top