FE659080

Overview
NameFE659080
Unique NameFE659080
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length182
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig379 contig Csv1_Contig379:865..1046. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Hong Anliu sweet orange SSH librarycdna_library
Properties
Property NameValue
Genbank descriptionC19 Hong Anliu sweet orange SSH library Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FE659080 ID=FE659080|Name=FE659080|organism=Citrus sinensis|type=EST|length=182bp
ACAAAACTTCTTATCTCCATCTCAGCAGTAACCAAGGATCATATTTATAC
AGAAAAAAATGCCACGATTCTTTACAGCACTCTTCGCTGCACAAAGATTG
TCCAGAGCGCTGGCACAGCTACTACACTTGATAGAACCAAGGGCTCAAAT
ACTAAATATACAAGCCAACCCCACCAATTCAG
back to top