FE659074

Overview
NameFE659074
Unique NameFE659074
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length154
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13203 contig Csv1_Contig13203:109..262. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Hong Anliu sweet orange SSH librarycdna_library
Properties
Property NameValue
Genbank descriptionC13 Hong Anliu sweet orange SSH library Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FE659074 ID=FE659074|Name=FE659074|organism=Citrus sinensis|type=EST|length=154bp
ACTAATGCAATACAGTATAATACAATACAATGTGCCAAACGCACCCTAAA
TACATTAAACTTCATTATAAAAAAGTCTACATTGGCATCATGCTCATCTT
ATAGTTGCCGGTATTAATTATTTTTGCACCATAGTTTCCGTAGAATCAAT
TGGG
back to top