FE659071

Overview
NameFE659071
Unique NameFE659071
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length155
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3719 contig Csv1_Contig3719:379..533. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Hong Anliu sweet orange SSH librarycdna_library
Properties
Property NameValue
Genbank descriptionC10 Hong Anliu sweet orange SSH library Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FE659071 ID=FE659071|Name=FE659071|organism=Citrus sinensis|type=EST|length=155bp
ACTTGGCCGTCACATTGGTAATTTATTAATTAAAACCAAAGGACACATTG
CTACAACAGGAGACAATAATGTTGCTCAAGCTATCGATGGATATGTGAAG
GAAAGAAAATGGCGTGTGACAGGACTGGTTATAGGGTCGTATTTGTCTGG
ATGGG
back to top