EY692344

Overview
NameEY692344
Unique NameEY692344
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1145
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-D07-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692344 ID=EY692344; Name=EY692344; organism=Citrus sinensis; type=EST; length=1145bp
TCCATTATTGTGGGTCCCTACCGGCTTCATCTTTAGATGCTTCTCTGTTT
GATTTGAGTCTCCTGCTGTGGAGCGCCTCCCTCAAATTCTAGTGGCTTTT
CTTTTATTTAACTTAAATGGATAGTGGAGCTGCTTCAAACACTTCTGGAA
GGTATTTAATCTGTTCTTCAGAAGTTGGGGTCTTCTGGTCTTTCTAAAAC
GAATGGGTTTGGAATATTGAAATCTAAGTTTAACATGAATTAAATAGATA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAACAAAATGCATAAAAACAAAGGAAACCCCGAACCTGAGAGTAGCGA
CGCCTCACGAAAGCGAAAGAAAGGTGTGTGCGCGGAGTCCTATTTATATT
TGGTATTTTTCGGATATGCAGTTTAAATGAAGAGTGGAGTGATCCATGAA
TATATATAGACTATAACCCCTATTTTTATACCTTTAATCAAGTTCACCCC
ATAAGAAAAAATCGAGATAAAAAAAACAACCACAATAACTAGAATATTTA
AAACAATTACGAAAGTTATTGTGAAACGCCTATATGAGGCGACTACCTAC
AAGAGGGCCCGCAAGAAAAAATAAACATAAGAAGACACGTCTAAAATAGA
ATCATATAAGATATGAAATAAAAAATATATTAACAATAATTTTTTATCCC
AGGATATACACCTTTCTTATTTTACCTTTTCCTTTTTGATCGCTACTTTT
GTCCTAAGTGTTTTATTCCCACACATATACACAATCAAAATATGATATAT
TTCAGAAATTTATTTTAAATTGTTAAATAATTTAACTTTATTTATGATGT
GTCTATCAGCCATATATCACCTAAATATATATGATAATAAAATGAGAATT
TAATTTAATAAATACTTAAAATAATATAACATGAATAATAAATAAAATTG
TAGTTGATGAATGAGCTTGAAACATAACATTTGATTTGTGTGCATAAACT
TAACTCTTCTACACTACGATTTTATTTACTTTCATTTGATCGCTCGCAAT
CATGCTCCCTCCCCCANCCTTTCCTTGAGGCCTTTTGGGGCTTCC
back to top